دانلود پایان نامه

تخلیص شده مورد بررسی قرار گیرد. برای تعیین کیفیت و کمیت DNA می توان از دستگاه اسپكتروفتومتر نانودراپ و یا برای تعیین کیفیت DNA می توان از روش الکتروفورز ژل آگارز عمل کرد. در این مطالعه از هر دو روش برای سنجش کیفیت و کمیت DNA استفاده شد؛ هر کدام این روش ها در ذیل آمده است.
2-4-1- تعیین کیفیت و کمیت ژنوم با استفاده از دستگاه اسپكتروفتومتر نانودراپ :
معمول‌ترين روش جهت تعيين غلظت DNA، استفاده از دستگاه اسپكتروفتومتر است. با استفاده از دستگاه اسپكتروفتومتر معمولی جذب محلول رقیق شده DNA در طول موج 260 نانومتر (طول موج جذب اسیدهای نوکلئیک) و 280 نانومتر (طول موج جذب پروتئین ها) اندازگیری و در نهایت نسبت جذب نوری محلول های DNA در طول موج 260 به 280 نانومتر (280/260=r) که شاخص میزان خلوص DNA می باشد، بدست می آید. اين نسبت بايد بين 8/1 تا 2 باشد. اگر نسبت كوچك‌تر از 8/1 باشد، آلودگي DNA را با پروتئين نشان مي‌دهد و نسبت بزرگ‌تر از 2 به دليل وجود RNA در نمونه مي باشد. از تقسيم جذب نوري (OD17) در طول موج 260 نانومتر به جذب نوري در طول موج 280 نانومتر، ميزان خلوص نمونه‌يDNA ، بدست می آید؛ همچنين جهت تعيين ميزان غلظت DNA از فرمول زير استفاده می شود.
ضریب رقّت * 50 * مقدار جذب در nm260 = غلظتDNA (بر حسب نانوگرم بر میکرولیتر)
برای بررسی کمیت وکیفیت  نمونه هاي تخليص شده در این پژوهش از دستگاه اسپکتروفتومتر نانودراپ استفاده شد. این دستگاه تنها با استفاده از 1 الي 2 ميكروليتر از نمونه قادر است در زماني كمتر از 10 ثانيه كليه طول موجهاي موجود در طيف مورد نظر را با دقت 1 نانومتر، اسكن نمايد و غلظت يا جذب نوري ماده مورد نظر را نيز تعيين كند. با توجه به سرعت بسيار بالاي دستگاه و ميزان كم نمونه مصرفي، كاربران اين دستگاه قادر خواهند بود ضمن صرفه جويي در زمان و هزينه، بسياري از آزمايشات ژنوميكس، پروتئوميكس و بيوشيمي را كنترل كيفي و بهينه نمايند. یکی از ويژگي هاي این دستگاه اندازه گيري و تعيين غلظت DNA در حجم يك ميكروليتر بدون احتياج به رقيق سازي نمونه می باشد (79).
میانگین غلظت DNA در این پژوهش 225 نانوگرم بر میکرولیتر و میزان خلوص آن 86/1 نانومتر بدست آمد.

2-4-2- تعیین میزان کیفیت ژنوم با استفاده از الکتروفورز :
به منظور كيفيت سنجي DNA استخراج شده، از دستگاه الكتروفورز نیز استفاده شد. در این روش، میزان خرد شدگی DNA تخلیص شده، بر حسب گستره ای که پس از الکتروفورز DNA بر روی ژل باقی می ماند تعیین می گردد. جهت تعيين كيفيت DNA استخراج شده، میزان μl4 از محلول حاوی DNA را به همراه μl2 مخلوط محلول رنگ Syber gold)، Loader buffer و (DMSOکه قبلاً تهیه کرده ایم پیپتینگ می کنیم سپس آن را بر روی ژل آگارز 1% و به مدت يك ساعت با ولتاژ 80 ولت، الکتروفورز نموده؛ در انتها به وسیله دستگاه UV transdocumenter به طور مستقیم از ژل عکس می گیریم. عکس زیر نمونه ای از الکتروفورز ژل آگارز DNA را نشان می دهد.

شکل(2-1): الکتروفورز ژل آگارز DNA

2-5- واكنش زنجيره‌اي پليمراز (PCR) :
واکنش PCR18 که هدف آن تكثير انتخابي جایگاه مشخصی از کل ژنوم موجود در محیط واکنش است، در سال 1983 توسط کری مولیس ابداع شد.
در طی این واکنش دمای بالا (°C94) جانشین عدم حضور آنزیم های توپوایزومراز ضروری برای جداسازی موقت دو رشتة DNA از هم گردیده است. آنزيم DNA پليمراز استخراج شده از باكتري ترموس‌آكواتي‌كوس19، یکی از آنزیم های کاندیدی است که به دلیل قابلیت تحمل حرارت بالا مورد توجه بسیاری از محققین نیازمند بکارگیری PCR قرار گرفته است. اساس واکنشPCR، تکثیر یک جایگاه خاص است که معمولاً شامل تکرار چرخشی30-25 مرتبه ای سه مرحله ی 1) جداسازی دو رشتة الگو از هم در نتیجة حرارت بالای موجود در محیط، 2) اتصال آغازگرها به الگوی مکملشان و 3) تکمیل توالی طی عملکرد DNA پليمراز می باشد، که به ترتیب تحت نام های Denaturing، Annealing و Extension ذکر می شوند؛ نتیجه نهایی PCR دستیابی به کپی های چند صد میلیونی از جایگاه مد نظر است (23).
2-5-1- مراحل PCR :
همانطور که پیشتر عنوان شد؛ هر واکنش PCR در عمل تکرار چرخشی سه مرحلة Denaturation ، Annealing و Extentionمی باشد، که مورد بررسی اجمالی قرار می گیرد.

دمای واسرشته سازی ( Denaturation):
انجام پلیمریزاسیون DNA، مستلزم جدا شدن دو رشتة دایمر آن از هم است. وجود آنزیم های توپوایزومراز و هلیکاز به همراه ترکیبات پروتئینی در شرایط طبیعی واکنش جداسازی دو رشته DNA را از هم کاتالیز می کنند. درجه حرارت °C94 در واکنش PCR جایگزین استفاده از این آنزیم ها می شود. در این دما پیوندهای هیدروژنی بین پلی نوکلئیک های مارپیچ دوگانه شکسته شده، DNA هدف، دناتوره و تک رشته ای می شود.
دمای اتصال (Annealing) :
در این مرحله دمای مخلوط واکنش به 50 تا 60 درجه سانتی گراد رسانده می شود. اگر چه این عمل سبب اتصال دوباره برخی از تک رشته های DNA هدف به یکدیگر و تشکیل مارپیچ دوگانه می گردد ولی این امکان را فراهم می کند تا آغازگرها به محل اتصال خود بچسبند.
دمای تکثیر (Extention) :
دمای مناسب در این مرحله معمولاً همان دمای بهینه برای فعالیت Taq پليمراز؛ یا همان °C72 است. فاکتور تعیین کننده در موفقیت این مرحله انتخاب زمان است که با توجه به طول جایگاه مورد نظر از 1 تا 2 دقیقه متغیر خواهد بود.
همانطور که قبلاً ذکر شد 25 الی30 بار تکرار چرخشی این سه مرحله در نهایت موجب دستیابی به میلیون ها کپی از جایگاه مد نظر می گردد که می تواند در ارزیاب
ی ها و واکنش های ملکولی تکمیلی بعدی مورد استفاده قرار گیرد (23).

2-6- روش تکثیر متزلزل جهش ها(ARMS-PCR) :
روش ARMS20-PCR اولین بار توسط Newton و همکاران در سال 1989 بعنوان یک تکنیک عمومی جهت تشخیص جهش نقطه ای معرفی گردید.
روش ARMS استاندارد که قابلیت تشخیص چندشکلی های تک نوکلئوتیدی شناخته شده را دارد، شامل دو واکنش PCR همزمان می باشد: یک واکنش شامل آغازگر اختصاصی برای توالی DNA نرمال که نمی تواند DNA موتانت را تکثیر نماید و واکنش دیگر که حاوی آغازگر اختصاصی مکمل توالی مربوط به آلل موتانت است و قادر به تکثیر DNA طبیعی نمی باشد. ژنوتیپ افراد با آنالیز محصولات تکثیر شده قابل تعیین می باشد. برای فرد هموزیگوت تکثیر تنها در یکی از واکنش ها صورت می گیرد و برای ژنوتیپ هتروزیگوت محصولات PCR در هر دو واکنش بدست می آیند. بنابراین می توان گفت در این روش تولید یا عدم تولید محصول PCR بعنوان معیار تشخیصی جهت بررسی حضور یا عدم حضور آلل مورد نظر استفاده می شود (شکل2-2) (34).

شکل(2-2): روش ARMS-PCRدارای سه پرایمر نرمال، موتانت و مشترک (34)

روش ARMS دارای چندین مزیت نسبت به سایر روش های تشخیصی مبتنی بر PCR مانند PCR-RFLP می باشد. این روش سریع، قابل اعتماد، ارزان و با قابلیت تکرارپذیری بالا می باشد و با یک روز کار امکان دستیابی به نتیجه وجود دارد (34). در اين بررسي طراحى پرايمرها به كمك نرم افزار Gene Runner انجام شد. مشخصات این پرايمرها در جدول (2-3) آورده شده است.
جدول (2-3): توالی آغازگرهای به کار رفته در روش ARMS-PCR
GC %
طول آغازگرها
توالی آغازگرها ´3´→ ۵
نام جایگاه
ردیف

8/46%

bp 342
F:GCACTGGGAGCATTGAGGATT
R: GCACTGGGAGCATTGAGGATC
C:TCTAGAAACAGTTGCCTGGCAG
G20210A
(Prothrombin)
1
6/34%
bp 205
F:AGTTGTATGACAAGTAAATGAGT
R: AGTTGTATGACAAGTAAATGAGC
C:GAAGCTCCAAGAAACCATC
-455G/A
(FGB)
2

4/58%

bp 149
F: CAGAGAGAGTCTGGACACGTGAGGA
R: CAGAGAGAGTCTGGACACGTGAGGG
C: GCATGCAGCCAGCCACGTG
4G/5G
(PAI-1)
3

2-7- کنترل داخلی :
کنترل داخلی21 در مورد همه نمونه ها که دارای جهش یا فاقد جهش هستند، تکثیر خواهد شد. کنترل داخلی نشان دهنده کنترل مثبت تکثیر در داخل لوله می باشد و به منظور اطمینان از روش ARMS-PCR مورد استفاده قرار می گیرد (51). در این مطالعه برای انتخاب کنترل داخلی سه مورد را در نظر گرفتیم؛ طول باند قطعه ژنی که به منظور کنترل داخلی استفاده شد با طول باند ژن های مورد بررسی متفاوت می باشد. دمای اتصال این دو ژن به هم نزدیک است و در انتها کنترل داخلی از لحاظ تشکیل ندادن ساختار ثانویه به وسیله نرم افزار Primer Premier 6 مورد بررسی قرار گرفت. برای(4G/5G) PAI-1-675 و FGB-455G/A از آغازگر اختصاصی پروموتر ژن HBG1 (هموگلوبینγ-1) و برای PT G20210A از KLF1(Exon-1) استفاده شد. اطلاعات مربوط به کنترل های داخلی به کار رفته، در جدول زیر آورده شده است.
جدول(2-4): توالی آغازگرها، به منظور کنترل داخلی
طول آغازگرها
(کنترل داخلی)
GC %
توالی آغازگرها (کنترل داخلی)
´3´→ ۵
نام جایگاه
(کنترل داخلی)
bp 546
50%
6/66%
F: AACGGCTGACAAAAGAAGTCCTGG
R:TGCCAGGCACAGGGTCCTTCC
HBG1
bp 629
45
6/52
F: ACGGTTGTTGCTGTTTACTG
R:TCAGGTCAAGATGCAGGTC
KLF1(EX1)

2-8- تهیه مخلوط PCR :
مواد و غلظت مورد نیاز برای انجام PCR در جداول (2-5) و (2-6) و (2-7) آورده شده است. حجم مورد نیاز برای هر یک از اجزاء PCR را به تعداد نمونه هایی که برای انجام PCR در نظر داریم می- رسانیم. برای هر نمونه نیاز به دو مخلوط PCR که شامل آغازگرهای اختصاصی مورد مطالعه می باشند، داریم. دو میکروتیوپ 5/1 برای هر یک از آغازگرهای اختصاصی در نظر می گیریم و اجزاء واکنش را به درون میکروتیوپ منتقل (به غیر از DNA)، سپس آن را جهت یکنواخت شدن پیپتینگ می کنیم. این مخلوط را به داخل میکروتیوپ های مخصوصPCR اضافه می کنیم؛ سپس DNA هر فرد را نیز به میکروتیوپ های محتوی اجزاء PCR اضافه می کنیم. در نهایت میکروتیوپ ها را Spin می کنیم و داخل Block دستگاه ترموسایکلر قرار داده، سپس دستگاه را روشن می کنیم.
لازم به ذکر است تمامی مراحل PCR با دستکش و بر روی میز PCR (استریل شده) انجام گرفت. برنامه PCR جهت تكثير ژن های مورد بررسی در جداول (2-8)، (2-9) و (2-10) آورده شده است.

جدول(2-5): غلظت نهایی اجزای واکنش PCR به منظور تکثیر ژن PT G20210A
اجزای واکنش
حجم (µl)در µl 15 مخلوط PCR

غلظت در حجم نهایی
µl 15
غلظت پایه
PCR مسترمیکس
5/7
X1
X2
آغازگر اختصاصی برای نوکلئوتیدG
9/0

pm/µl 6/0
10
آغازگر اختصاصی برای نوکلئوتیدA
9/0

pm/µl 6/0
10
آغازگر مشترک (Common)
45/0
pm/µl 3/0
10
آغازگر Forward-KLF1(Exon-1)
6/0
pm/µl 4/0
10
آغازگر Reverse-KLF1(Exon-1)
6/0
pm/µl 4/0
10
DNA
8/1

Ddw
تا حجم µl15
_
_

جدول(2-6): غلظت نهایی اجزای واکنش PCR به منظور تکثیر ژن FGB-455G/A
اجزای واکنش
حجم (µl)در µl 15 مخلوط PCR

غلظت در حجم نهایی
µl 15
غلظت پایه
PCR مسترمیکس
5/7
X1
X2
آغازگر اختصاصی برای نوکلئوتیدG
9/0

pm/µl 6/0
10
آغازگر اختصاصی برای نوکلئوتیدA
9/0

pm/µl 6/0
10
آغازگر مشترک (Common)
45/0
pm/µl 3/0
10
آغازگر Forward- HBG1
2/0
pm/µl 4/0
10
آغازگر Reverse- HBG1
2/0
pm/µl 4/0
10
DNA
8/1

Ddw
تا حجم µl15
_
_

جدول(2-7): غلظت نهایی اجزای واکنش PCR به منظور تکثیر ژن (4G/5G) PAI-1-675
اجزای واکنش
حجم (µl)در µl 15 مخلوط PCR

غلظت در ح
جم نهایی
µl 15
غلظت پایه
PCR مسترمیکس
5/7
X1
X2
آغازگر اختصاصی برای نوکلئوتید4G
9/0

pm/µl 6/0
10
آغازگر اختصاصی برای نوکلئوتید5G
9/0

pm/µl 6/0
10
آغازگر مشترک (Common)
45/0
pm/µl 3/0
10
آغازگر Forward- HBG1
2/0
pm/µl 4/0
10
آغازگر Reverse- HBG1
2/0
pm/µl 4/0
10
DNA
8/1

Ddw
تا حجم µl15
_
_

مطابق جدول(2-8): برنامه PCR جهت تكثير ژن PT G20210A
مرحله
دما (C˚)
زمان (دقيقه)
تعداد سيكل
دناتوراسیون اولیه
94
5 دقیقه
1
دناتوراسیون
94
40 ثانیه

30

اتصال
62
45 ثانیه

تکثیر
72
45 ثانیه

تکثیر نهایی
72
5 دقیقه
1

مطابق جدول(2-9): برنامه PCR جهت تكثير ژن β- فيبرينوژن
مرحله
دما (C˚)
زمان (دقيقه)
تعداد سيكل
دناتوراسیون اولیه
95
5 دقیقه
1
دناتوراسیون
94
40 ثانیه

30

اتصال
59
40 ثانیه

تکثیر
72
40 ثانیه

تکثیر نهایی
72
3 دقیقه
1

مطابق جدول(2-10): برنامه PCR جهت تكثير ژن PAI-1
مرحله
دما (C˚)
زمان (دقيقه)
تعداد سيكل
دناتوراسیون اولیه
95
3 دقیقه
1
دناتوراسیون
94
30 ثانیه

30

اتصال
66
40 ثانیه

تکثیر
72
30 ثانیه

تکثیر نهایی
72
5 دقیقه
1

2-9- الكتروفورز:
الکتروفورز در ژل یک روش استاندارد جهت جداسازی مولکولهای DNA با اندازه های مختلف است. این روش کاربردهای بسیاری در ارزیابی قطعاتDNA دارد، همچنین می تواند برای جداسازی مولکولهای RNA نیز مورد استفاده قرار گیرد. الکتروفورز حرکت مولکولهای باردار در میدان الکتریکی است، مولکولهای دارای بار منفی به سمت الکترود مثبت و مولکولهای دارای بار مثبت به سمت الکترود منفی حرکت می کنند. دو نوع ژل در بیولوژی مولکولی کاربرد دارند که شامل ژل پلی آکریل آمید(PAGE) و ژل آگارز می شوند (22). در این مطالعه به الکتروفورز در ژل آگارز می پردازیم.
2-9-1- الكتروفورز بر روي ژل آگارز :
آگارز در واقع پليمری پلي‌ساكاريدي می باشد، كه از نوعي جلبك قرمز دريايي استخراج مي‌شود. ترکیب خالص این ماده پودر سفید رنگ بی بو و بی مزه ای است که قابلیت جذب آب فراوان دارد. این ترکیب در آب سرد نامحلول بوده و ترکیب کلوئیدی ایجاد می کند. افزایش دمای این محلول کلوئیدی نهایتاً موجب انحلال کامل آگارز می شود، سرد شدن مجدد مجموعه، با ایجاد باندهاي هيدروژني بین زنجيره‌هاي پليمری شبكه‌اي با چگالي بسيار بالا ایجاد خواهد کرد. چنین بستری زمینة انتخابی برای جداسازی ملکول های اسید نوکلئیک را به راحتی فراهم می نماید. حركت


پاسخی بگذارید